METHODS
Using quantitative real-time PCR, the expression level of the CEBPA gene was examined in the bone
marrow samples of 44 MM patients and 13 healthy controls. Statistical analyses were performed using
SPSS, 13.3.1, and p<0.05 was evaluated as statistical significance level.
RESULTS
Although there was a decrease CEBPA expression levels in the patient group compared to the control
group, no statistically significant relationship was found in terms of CEBPA gene expression level and
MM compared with the controls (p=0.436).
CONCLUSION
Our findings suggest that the change in the expression level of CEBPA transcript itself has probably no
effect in the pathogenesis of MM patients, although it is an important problem that needs further researches
with large-scale samples.
Keywords: Bone marrow; CEBPA; gene expression; multiple myeloma; transcription factor
The malignant transformation of B-cell or plasma
cell into MGUS and subsequently MM requires both
an initiating event and multiple secondary genetic
events. Initiating events are broadly subdivided into
IgH translocations or hyperdiploidy. In the continuum
of disease stages, genetic lesions accumulate in the tumor
clone. Although there are still unknown points in
the formation and progression of MM, upregulation
of cyclin D expression appears to be a necessary occurrence
early stage of MM. The next stage in MM etiology
is non-random trisomies, CNVs, translocations
containing IgH, FGFR3, MMSET, transcription factors
(MAF and MAFB), inactivation of tumor suppressor
genes (pRB and p53), and activation of oncogenic
genes (MYC and RAS), deletions, and other chromosomal
rearrangements.[
Transcription factors, due to their wide range of cellular
functions, can be shown among the genes that are
expected to be affected first in this process.[
Thus, our aim was to evaluate whether the expression
levels of CEBPA display in bone marrow samples
from patients diagnosed with MM and the bone marrow
of healthy controls using qPCR method.
Patients
For this investigation, bone morrows of 44 patients
diagnosed with MM (17 females and 27 males) were
collected from the department of hematology-oncology
and 13 healthy control bone marrows (eight males
and five females). Bone marrow samples of the control
group had been taken from the sternum of individuals
who have not taken any hematological disease diagnosis
during cardiac surgery (aspirated from surgical area and
not used in any diagnosis and treatment) recruited from
the Department of Cardiac Surgery, Mersin University
Hospital, Mersin, Turkey. The suitability of the number
of individuals in the patient and control groups included in our study was statistically tested with "power
analysis" before the study in terms of the effectiveness
of the study (data not provided). Written informed
consent was obtained from all participants before their
participation. Our study was approved by the Medical
Sciences Ethical Committee of Mersin University. The
study was planned and conducted in accordance with
the principles of the Declaration of Helsinki.
Total RNA Isolation and cDNA Synthesis
First, the total RNA was isolated from bone marrow of
patients and healthy individuals using TRIzol reagent
(Invitrogen). Following isolation, the quality of all RNA
samples was checked using a NanoDrop spectrophotometer
(Thermo Scientific, Wilmington, DE, USA).
All samples demonstrated high purity (OD 260/280
nm ratio >1.8). Second, the reverse transcription reaction
was performed to obtain cDNA using an automated
Thermal Cycler (Veriti, Applied Biosystems).
The reaction conditions were as follows: 37°C for 60
min and 95°C for 5 min. A total cDNA reaction volume
of 50 µL included 2 µg/µL of RNA sample, 200 U/
µL RevertAid Reverse Transcriptase (0.2 µL) (Thermo
Scientific, Vilnius, Lithuania), 5× RT buffer (8 µL), 5
µl poly-T primer (5 µL), 2 mM each of dNTPs (20 µL),
40 U/µl of RiboLock RNase inhibitor (0.5 µL) (Thermo
Scientific, Vilnius, Lithuania), and nuclease-free water.
Real-Time PCR Analysis
Quantitative analysis of CEBPA gene was run
on an ABI Prism 7500 Real-Time PCR System
(Applied Biosystems) using the following
primers and probes used in the present study; F: 5"
CAAATATTTTGCTTTATCAGCCGATA-3" and R:
5"-CGCACATTC ACATTGCACAA-3" Prob: 5"-FAMACACTTGTATCTGGCCTCTGTGCCCCA-
BHQ 1-3"
for CEBPA; F: 5"-GGCACCCAGCACAATGAAG-3"
and R: 5-GCCGATCCACACGGAGTACT-3", Prob:
5-Yakima Yellow TCAAGATCATTGCTCCTCCTGA
GCGC-BHQ-1-3" for the housekeeping gene, beta-
actin (ACTB). All reactions were conducted in 20
µL final volume including 12.5 µL of TaqMan Gene
Expression Master Mix (Applied Biosystems), 5 µL
cDNA, 2.5 µL 900 nmol each primer, 1 µL 200 nmol
of each TaqMan® probes, and nuclease-free water. PCR
parameters were started after pre-incubation at 50°C
for 2 min and denaturation at 95°C for 10 min followed
by 50 cycles of 95°C for 15 s and 60°C for 1 min. Trials
were conducted in duplicate for each data point. The
2-ΔΔCt method was used to measure changes in the gene
expression detected by qPCR analysis.
Statistical Analysis
Statistical analyses were performed using the Statistica
13.3.1 software. Shapiro-Wilk test was used to test the
normality assumption and to analyze the homogeneity
of variance, Levene's test was performed. The nonparametric
method, Mann-Whitney U-test, was used
to compare two groups for non-normal distributions.
Numerical data were summarized as mean (standard
deviation) or median (percentiles). The relationship
between categorical variables was evaluated using Chisquare
statistics. Statistical significance level was determined
as p<0.05.
The mRNA expression level of the selected gene according to age and gender of the studied cohort was rated and no statistically significant correlation was observed depending on these two parameters (p=0.276 and p=0.870, respectively).
The analysis also revealed that the median CEBPA
expression level in MM patients was downregulated
from the level found in the control group (Fig.
CEBPA: CCAAT enhancer-binding protein alpha; MM:
Multiple myeloma.
Acknowledgments: The authors thank the patients and the control persons for their participation in this study. This work was supported by the Mersin University Research Foundation under Grant BAP-SBE 2019-1-TP2-3206.
Peer-review: Externally peer-reviewed.
Conflict of Interest: All authors declared no conflict of interest.
Ethics Committee Approval: The study was approved by the Mersin University Health Sciences Ethics Committee (No: 2018/469, Date: 21/11/2018). The study was planned and conducted in accordance with the Helsinki Declaration principles.
Financial Support: This study has received no financial support.
Authorship contributions: Concept - M.E.A., T.K.; Design - M.E.A., T.K., A.T.; Supervision - M.E.E., Ö.İ.A., M.E.A.; Funding - None; Materials - A.T.; Data collection and/or processing - T.K., K.Ç.; Data analysis and/or interpretation - M.E.A., T.K., A.T., Ö.İ.A., K.Ç.; Literature search - T.K.; Writing - M.E.A., T.K., K.Ç.; Critical review - Ö.İ.A.
