C Deletion in Exon 4 Codon 63 of p53 Gene in Turkish Patients with Oral Squamous Cell Carcinoma

Introduction

Methods

Genotyping
The DNA of the participants was isolated from peripheral blood mononuclear cells using a DNA extraction kit, according to the manufacturer"s instructions (Sigma- Aldrich, Taufkirchen, Germany). The C-deletion in exon 4 codon 63 of p53 gene was genotyped in all the subjects by the polymerase chain reaction (PCR) analysis, as described method previously.[] PCR reaction was carried out in a 25 µl reaction volume containing 1 µg/µl of genomic DNA, 2.5 µl of 10X Taq polymerase buffer with 1.5 mM MgCl₂, 200 µM of each dNTPs,15µg of each primer and 1 unit of Taq DNA polymerase µl. On the basis of sequence, the primers were constructed for C-deletion on codon 63 of exon 4 of p53 gene as F- 5" GGTCCAGATGAAGTCCCAGAA and R-5"-CGTGCAAGTCACAGACTTGGC. A negative control, without template DNA was included in each round of reactions. PCR thermal was performed in 35 cycles. Each cycle consisted of 94°C denaturation for 45 s, 57°C annealing for 45 s, and 72°C extension for 1 min. The thermal cycles were started with an initial denaturation of 96°C for 5 min and a final 72°C extension for 10 min for polishing the ends of PCR products.The thermalcycles were started with an initial denaturation of 96°C for 5 min and a final 72°C extension for 10 min for polishing theends (making smooth) of PCR products.

Construction of Primer Against C Deletion on Exon 4 of p53 Gene
On the basis of sequence, the primers were constructed for C deletion on codon 63 of exon 4 of p53 gene as 5"-GGTCCAGATGAAGTCCCAGAA (upstream) and 5"-CGTGCAAGTCACAGACTTGGC (downstream). The annealing temperature of constructed primers was estimated as 58°C and the PCR amplification reaction was done as described above.

Agarose Gel Electrophoresis
Resulting PCR products were resolved (15 µl PCR product mixed with 2 µl gel loading dye) on 1.5% agarose gel using submarine gel electrophoresis for one hour in 1X TBE buffer (Tris HCl, boric acid, EDTA; pH 8.0). Subsequently, gels were stained with ethidium bromide (10 mg/l) and photographed on a UV transilluminator using a gel documentation system.

Statistical Analysis
All statistical analyses were performed with the Statistical Package for the Social Science for Windows (version 18.0; SPSS Inc., Chicago, IL, USA). Continuous data were given as means±SD and minimum/maximum. The ?2 test was used to measure significance of differences in the allele frequency and genotype distribution between the two study groups. Odds ratio (OR) and 95% confidence intervals (CI) were calculated. A p-value≤0.05 was considered statistically significant.

Results

Table 1: The demographical characteristics of the study subjects

The C-deletion mutation in exon 4 codon 63 of p53 gene among the OSCC patients and controls are shown in Table 2. There was a significant difference between OSCC patients and controls. All patients appeared Cdeletion exon 4 codon 63 of p53 gene (p=0.000).

Table 2: C-deletion mutation in exon 4 codon 63 of p53 gene in groups

Discussion

Carcinogenesis is a complicated and multi-factorial process in which genetic events within signal transduction pathways executing normal cellular physiology are changed.[] Cancer is the result of an amassing of alterations in the excitatory and inhibitory cellular pathways, which may take place at any level of a certain pathway. It is believed that somatic mutations ranging between three to six are required for transforming a normal cell into its malignant one.[] p53 is an important tumor supressor gene. This gene found on chromosome 17p 13.1 encodes a 53-kDa, 393 amino acid nuclear phosphoprotein. Wild-type p53 protein functions as a DNA-binding transcription factor and results in the control of the cell cycle by G1/S phase detainment following sublethal DNA damage.Hence, providing extra time for repair prior replication or the induction of apoptosis if the damage is too severe.[] It is also believed that of over half of human tumors that display mutations in the p53 gene have dysfunctional p53 signaling. The prevalence of p53 mutations also depend on the tumor type. The majority of p53 mutations found in human cancer map to the DNA-binding surface of the p53 protein, comprising two large loops, L2 (residues 163-195) and L3 (residues 236-251) and a loop-sheet-helix motif.[]

Comprehensive genomic studies have indicated that p53 mutations occur commonly in head and neck squamous cell cancers. Missense, stop-gain, splice site, frameshift deletions, and inframe deletions are among the various types of p53 mutations that are implicated in the early stages during the carcinogenetic process of the corresponding epithelia. Missense and truncating mutations are related with malignant cell proliferation, enhanced invasion, and resistance to chemotherapeutic regimens. All of these histological and biochemical factors play a role in poor prognosis (decreased drug response rates and short survival span), particularly in missense mutations carriers. Lazarus et al. reported that incidence of p53 mutations have been found in approximately 63% of OSCC.[] Hsieh and Wang et al.reported that mutation in p53 is detected in 48% of tumor samples. [] Zanaruddin et al. found that p53 mutations were present in 27.7% of the OSCC specimens.[] A study group analyzed a large number of OSCC tissues and found that p53 mutations are associated with lower survival rates in these patients.[]

In this study, we investigated the association between C-deletion exon 4 codon 63 of p53 and OSCC in Turkish patients. To our knowledge, this research is the first to study evaluating this deletion in our OSCC patients. We found that all patients had C deletion mutation in exon 4 codon 63 of p53 gene. The patients carrying p53 C deletion had 17.957-fold increased risk for OSCC (p=0.000). High mutation rate may be due to ethnic differences.

There were several limitations to this study.Expression of p53 in biopsy tissue samples was not studied. Secondly, study population represented relatively small sample size. Also, the absence of examination of other mutations regarding p53 is another limitation.

Conclusion

Peer-review: Externally peer-reviewed.

Conflict of Interest: The authors declare that they have no conflict of interest.

Ethics Committee Approval: This study protocol was approved by the Local Ethics Committees in accordance with the ethical standard for human experimentation established by the Declaration of Helsinki.

Financial Support: This study was supported by Ahi Evran University BAP (SYO.A4.16.002) program.

Authorship contributions: Concept - A.T., S.Y., O.G.; Design - S.Y., A.F.N.; Supervision - O.G., A.F.N.; Funding - None; Materials - S.Y., M.K.T., O.G.; Data collection and/or processing - A.T., O.G.; Data analysis and/or interpretation - S.Y., A.F.N.; Literature search - A.F.N., M.K.T.; Writing - A.F.N.; Critical review - S.Y., S.Y., M.K.T.

References